Review



monarch spin dna gel extraction kit neb cat  (New England Biolabs)


Bioz Verified Symbol New England Biolabs is a verified supplier
Bioz Manufacturer Symbol New England Biolabs manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
  • 99

    Structured Review

    New England Biolabs monarch spin dna gel extraction kit neb cat
    Monarch Spin Dna Gel Extraction Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1424 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+dna+gel+extraction+kit+neb+cat/Monarch+Spin+DNA+Gel+Extraction+Kit/10__1016_slash_j__isci__2026__115975-165-131-137
    Average 99 stars, based on 1424 article reviews
    monarch spin dna gel extraction kit neb cat - by Bioz Stars, 2026-09
    99/100 stars

    Images

    Related Articles

    Recombinant:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    Protease Inhibitor:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    Purification:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    Plasmid Preparation:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    Gel Extraction:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    Mass Spectrometry:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    RNA Sequencing:

    Article Title: Presentation of identical tumor antigen peptides by canine and human MHC class I
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER Antibodies Anti-MHC Class I (HLA-A, HLA-B, HLA-C) – human, Clone W6/32 BioXCell Cat# BE0079; RRID: AB_1107730 Mouse anti-MHC class I monoclonal antibody, Clone DG-H58A Monoclonal Antibody Center, Washington State University Cat# DG-BOV2001; RRID: AB_3718131 Anti-Human HLA A2, B7 (MHC Class I), Clone BB7.6 Leinco Technologies RRID: AB_2893725 Bacterial and virus strains OneShot Top10 Chemically Competent ThermoFisher Cat# C404003 Biological samples Canine tumor samples Collected from veterinary hospitals with owner informed consent. .. N/A Chemicals, peptides, and recombinant proteins RPMI 1640 Gibco Cat# 11875119 DMEM/F-12 Gibco Cat# 11320082 PBS Gibco Cat# 20012027 FBS Gibco Cat# A5256701 CNBr-activated Sepharose 4 Fast Flow Amersham Pharmacia Biotech/Cytiva Cat# 17-0981-01 Tris pH 8.0 NELS Cat# E199-500 ML IGEPAL® CA-630 Sigma-Aldrich Cat# 18896 Complete protease inhibitor cocktail Roche Cat# 11836145001 Glacial Acetic acid Sigma-Aldrich Cat# AX0077 iRT peptides Biognosys Cat# 1900615 Transporter 5 Polysciences Cat# 26008 Xho1 NEB Cat# R0146S Salt-T4 DNA Ligase NEB Cat# M0467S EcoR1 NEB Cat# R3101S LR Clonase II ThermoFisher Cat# 11791020 Polybrene Sigma-Aldrich Cat# TR-1003-50UL Blasticidin ThermoFisher Cat# A1113903 Critical commercial assays MelonTM Gel IgG Spin Purification Kit Thermo Scientific Cat# 45206 ZebaTM Spin Desalting Columns Thermo Scientific Cat# 89893 QIAfilter Plasmid Kits Qiagen Cat #12243 Monarch Plasmid Spin Miniprep Kit NEB Cat #T1110L Monarch Spin DNA Gel Extraction Kit NEB Cat #T1120L QIAamp DNA Blood Mini Kit Qiagen Cat #51106 Rapid Barcoding Kit 96 V14 Oxford Nanopore Technologies, UK Cat #SQK-RBK114.96 Deposited data Mass spectrometry data for DLAtransduced mono-allelic cells and all canine tumors This paper PXD074485 Canine tumors RNA-seq data The SRA database PRJNA1428288 (Continued on next page) e1 iScience 29, 115975, June 19, 2026 ..

    other:

    Article Title: Site-resolved assessment of targeted protein degradation.
    Article Snippet: REAGENT or RESOURCE SOURCE IDENTIFIER NuPAGE Tris-Acetate 3-8% Thermofisher Cat#EA0375BOX MES running buffer Fisher Cat#11519166 Tris-acetate Buffer Invitrogen Cat#LA0041 PageRuler Plus Prestained Protein Ladder Invitrogen Cat#26619 HiMarkTM Pre-stained Protein Standard Thermofisher Cat#LC5699 GeneRuler 1 kb Plus DNA Ladder Thermofisher Cat#SM1332 FastDigestTM DpnI Invitrogen Cat#FD1704 0.45 um PVDF membrane Merck Cat#ISEQ00010 TBS MRC PPU Reagent and Services N/A Tween-20 Sigma Cat#P9416 BSA Merck Cat#81053N BocK Bachem Cat#4017646.001 BCNK Sirius Fine Chemicals Cat#SC-8016 DMSO Sigma Cat#D2650 TAMRA-tetrazine Jena Bioscience Cat#CLK-017-05 Cell culture dishes (10 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#172931 Cell culture dishes (35 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#153066 Cell culture dishes (60 cm) Thermofisher Nunc brand (nunclon delta coated) Cat#174888 Cell culture dishes (6 well) Thermofisher Nunc brand (nunclon delta coated) Cat#140675 Cell culture dishes (12 well) Thermofisher Nunc brand (nunclon delta coated) Cat#150628 Cell culture dishes (24 well) Thermofisher Nunc brand (nunclon delta coated) Cat#142475 96 Well White Polystyrene Microplate Corning Cat#CLS3610-48EA MG132 WTS Cat#474790 MLN4924 CST Cat#85923S USP2 De Cesare et al. 54 N/A Critical commercial assays ECL Western Blotting detection reagent Cytiva Cat#RPN2232 Nano-Glo HiBiT Lyic detection reagent Promega Cat#N3030 Monarch® Spin Plasmid Miniprep Kit NEB Cat#T1110L Monarch® Spin DNA Gel Extraction Kit NEB Cat#T1120S Monarch® Spin PCR & DNA Cleanup Kit NEB Cat#T1130S Gibson assembly mix MRC PPU Reagent and Services N/A NucleoBond Xtra Midi Plus kit Macherey-Nagel Cat#740412.5 Experimental models: Cell lines Human: HEK293 ATCC RRID:CVCL_0045 Human: HEK293 HiBiT BRD4 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD3 Hsia et al. 38 N/A Human: HEK293 HiBiT BRD2 Hsia et al. 38 N/A Oligonucleotides Sequencing primer: EF1 Forward cactgagtgggtggagactg N/A Sequencing Primer: SV40 Reverse GAAATTTGTGATGCTATTGC N/A Primers for Gibson Assembly and site-directed mutagenesis, see Table S1 This paper N/A Recombinant DNA Plasmid: sp9 MmPylS Spear et al. 55 N/A Plasmid: pPylST WT This paper, MRC PPU Reagents and Services Database N/A (Continued on next page) Cell Chemical Biology 32, 1–13.e1–e7, July 17, 2025 e2



    Similar Products

    99
    New England Biolabs monarch spin dna gel extraction kit neb cat
    Monarch Spin Dna Gel Extraction Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+dna+gel+extraction+kit+neb+cat/Monarch+Spin+DNA+Gel+Extraction+Kit/10__1016_slash_j__isci__2026__115975-165-131-137
    Average 99 stars, based on 1 article reviews
    monarch spin dna gel extraction kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs monarch dna gel extraction kit neb cat
    Monarch Dna Gel Extraction Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+dna+gel+extraction+kit+neb+cat/Monarch+Spin+gDNA+Extraction+Kit/pm40890487-352-104-109
    Average 99 stars, based on 1 article reviews
    monarch dna gel extraction kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    99
    New England Biolabs e2621 monarch spin dna gel extraction kit neb cat
    E2621 Monarch Spin Dna Gel Extraction Kit Neb Cat, supplied by New England Biolabs, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/monarch+spin+dna+gel+extraction+kit+neb+cat/MonarchSpinDNA+Gel+Extraction+Kit/pm40157353-294-144-151
    Average 99 stars, based on 1 article reviews
    e2621 monarch spin dna gel extraction kit neb cat - by Bioz Stars, 2026-09
    99/100 stars
      Buy from Supplier

    Image Search Results